Sign Up to BioTechniques free email alert service to receive content updates.
Lectin-based affinity tag for one-step protein purification
 
Denis Tielker, Frank Rosenau, Kai-Malte Bartels, Thomas Rosenbaum, and Karl-Erich Jaeger
Heinrich-Heine-University Duesseldorf, Juelich, Germany
BioTechniques, Vol. 41, No. 3, September 2006, pp. 327–332
Full Text (PDF)
Abstract

The production of pure protein is indispensable for many applications in life sciences, however, protein purification protocols are difficult to establish, and the experimental procedures are usually tedious and time-consuming. Therefore, a number of tags were developed to which proteins of interest can be fused and subsequently purified by affinity chromatography. We report here on a novel lectin-based affinity tag using the D-mannose-specific lectin LecB from Pseudomonas aeruginosa. A fusion protein was constructed consisting of yellow fluorescent protein and LecB separated by an enterokinase cleavage site. This protein was overexpressed in Escherichia coli Tuner (DE3), and the cell extract was loaded onto a column containing a mannose agarose matrix. Electrophoretlcally pure fusion protein at a yield of 24 mg/L culture was eluted with a D-mannose containing buffer. The determination of equilibrium adsorption isotherms revealed an association constant of the lectin to the mannose agarose matrix of Ka=3.26×105/M. Enterokinase treatment of the purified fusion protein resulted in the complete removal of the LecB-tag. In conclusion, our results indicate that the lectin LecB of P. aeruginosa can be used as a tag for the high-yield one-step purification of recombinant proteins.

Introduction

The expression and purification of recombinant proteins still is an essential tool for various applications in life science, including enzyme characterization, crystallization, and antibody production. The purification of native proteins is often a problematic and time-consuming process, which has greatly been facilitated by the development of affinity tags. In the last few years, a number of different tags became commercially available (1). Generally, affinity tags can be divided into two categories: small peptide tags like poly-His (2) or Strep-tag (3) are less immunogenic than large proteins. They are considered not to affect the activity of the fused protein and, at least for many applications, their removal is not required. On the other hand, fusions to larger protein tags like glutathione S-transferase (4) or maltose binding protein (MBP) (5) can increase the solubility of the respective recombinant protein, but for many downstream applications the tag has to be removed, usually by hydrolysis using site-specific proteases. In view of the inherent drawbacks of the existing tag-systems, the development of new affinity tags still appears attractive.

Lectins represent a specific class of carbohydrate binding proteins different from enzymes or antibodies (6). They are found in a wide range of organisms including viruses, bacteria, plants, and animals and belong to one of several different families, many of which have been characterized structurally (7,8,9,10). LecB (alternatively PA-IIL) synthesized by the Gram-negative bacterium Pseudomonas aeruginosa is a tetrameric lectin with each monomer having a molecular mass of 11.73 kDa (11,12). This lectin exhibits a remarkably high binding affinity for L-fucose with an association constant in the micromolar range and also binds D-mannose, albeit with lower affinity (13). The structural basis of carbohydrate recognition and binding by LecB has recently been characterized in detail (14,15,16).

Presently, only few affinity purification systems are available, that are based on proteins with an intrinsic carbohydrate affinity; these include the cellulose binding domains (17), the MBP (5), and the chitin binding-domain (18). Here, we have used the lectin LecB as a fusion tag allowing for the one-step purification of a target protein by affinity chromatography.

Materials and Methods

Bacterial Strains and Plasmids

The strains and plasmids used in this study are listed in Table 1. Escherichia coli DHα was used for cloning experiments, and E.coli Tuner (DE3) was used as a heterologous expression host for plasmid-encoded YFP-LecB fusion protein.





Cloning of yfp::lecB

After digestion of the lecB carrying plasmid pEC2 with NdeIBamHI, the resulting 345-bp fragment encoding LecB was ligated into the same sites of pET19, giving pET19-lecB. Following hybridization of the two oligonucleotides PUREUP (5′-CATGGGCCAT CATCATCATCATCATATGCCCGG GGAGCTCCTCGAGGACGACGA CGACAAGGC-3′) and PUREDWN (5′-TAGCCTTGTCGTCGTCGTCC TCGAGGAGCTCCCCGGGCATAT GATGATGATGATGATGGCC-3′) a 60-bp fragment was obtained carrying recognition sites for the restriction enzymes NcoI, SmoI, SacI, and XhoI and additionally encoded an enterokinase cleavage site and a hexahistidine tag. This fragment was cloned into the NcoI/NdeI sites of pET19-lecB to give plasmid pURE. A 720-bp DNA fragment carrying the yfp gene excluding its stop codon was amplified by PCR using plasmid pFF19-EYFP as the template with oligonucleotide primers YFPXhoI (5′-CGCCTCG AGCTTGTACAGCTCGTC-3′) and YFPNcoI (5′-CATGCCATGGTGA GCAAGGGCGAG-3′), introducing an XhoI and NcoI site, represented in bold, respectively. This fragment was digested with XhoI/NcoI and cloned into the LecB-tag carrying plasmid pURE, resulting in plasmid pURE-yfp, which was then transferred into E. coli Tuner (DE3).

Overexpression of yfp::lecB

Expression cultures were grown at 30°C in 1 L Luria-Bertani medium containing 0.4% glucose and 100 µg/mL ampicillin in 5-L Erlenmeyer flasks to an absorbance of 0.6 and then induced with 1 mM isopropyl- β-D-thiogalactoside (IPTG). The production of the YFP-LecB fusion protein was monitored by fluorescence measurements at excitation and emission wavelengths of 485 and 514 nm, respectively. After 16 h of growth, cells were harvested by centrifugation at 3000× g for 10 min and suspended in 100 mL 100 mM Tris-HCl, pH 8.0.

  1    2    3    4  



Back to top