Many DNA binding proteins are known to regulate gene expression. When that binding is altered, a disease state can result. A common method for measuring DNA binding, namely electrophoretic mobility shift assay (EMSA) is often used but it is not amenable to rapid screening of many samples. As an alternative method, we have developed a DNA binding assay for the tumor suppressor protein p53 in a 96-well microtiter plate format using scintillation proximity assay (SPA) beads. We have shown this assay to be sensitive (as little as 0.5 ng p53 can be detected), quick (assay completed in as little as 15 min), and easily quantitated using a microtiter plate scintillation counter. We also used the assay to analyze the kinetics of the DNA binding to p53. The specificity of this p53 DNA binding SPA was confirmed using competition by oligonucleotides either from the same gene or from mutated versions of this sequence. Thus, SPA is a good alternative to gel shift assays for DNA binding and may be useful for the analysis of multiple tumor cell samples or for high-throughput screens for compounds affecting DNA binding by proteins of interest.

Introduction

DNA binding proteins regulate gene expression. An alteration in gene expression can, in some cases, lead to cancer. Assays to quantitate this change can potentially lead to earlier diagnosis and treatment of the disease. Additionally, the future of medicine is likely to concentrate more on the molecular aspects of disease with the development of new drugs focused on gene expression and regulation (1,2). The p53 tumor suppressor protein controls the cell cycle of normal cells by recognizing damaged DNA, which results in growth arrest or induction of apoptosis (programmed cell death) (reviewed in References (3) and (4). In addition to its normal functions, p53 also plays a central role in the progression of many types of cancer. A number of genes change in human cancer; by far the most common mutation is in the p53 gene (5). The mutations in p53 are often clustered in the DNA binding region or result in a truncated protein lacking this region (5,6,7). Studies with knockout mice lacking p53 indicate that they are prone to various types of cancer, and the p53 has been shown to be required in mouse thymocytes for apoptosis-induced by radiation (8). Mutations in the p53 gene are associated with increased risk in developing metastatic breast disease, poorer prognosis of patients with small-cell lung cancer, and decreased sensitivity of cancer cells to chemo-therapeutic agents (9,10,11,12). Thus, it may be possible that functional assays for p53 DNA binding could be used to monitor the progression of cancer and to determine appropriate modes of therapy. Generally DNA binding has been measured by electrophoretic mobility shift assays (EMSAs) or by filter binding (13,14), but neither is amenable to high-throughput screening. We have therefore chosen to develop a scintillation proximity assay (SPA) to measure DNA binding (Figure 1A). SPA beads, commercially available from GE Healthcare (Piscataway, NJ, USA), contain embedded scintillant that produces light when radioactive compounds are brought in proximity to the bead. Binding of these radioactively labeled compounds to the beads can occur through specific antibodies or other binding components (reviewed in Reference (15). This assay is fast partly because unbound material needs to be removed, as it does not contribute significantly to the signal. This assay has been used to measure serine kinase inhibitors and adenosine receptors—to name a few of the applications of this technology (16,17). In some cases, kits are available for these assays. We have used this approach to develop a SPA that measures DNA binding of human p53 protein, an assay that as yet does not have a convenient SPA kit (Figure 1A).

Figure 1. Scintillation proximity assay (SPA) for DNA binding by human p53. (Click to enlarge)

Materials and Methods

Preparation of Labeled DNA and p53 Protein

We prepared a double-stranded DNA probe, sequence 5'-(A)₁₉TGCCAAGGCTTGCCCGGGCAGGTCTGGCCT/AGGCCAGACCTGCCCGGGCAAGCCTTGGCA-3', from the cyclin G promoter region that was known to bind p53 in a sequence-specific manner (18), and used that to develop our SPA DNA binding assay. The DNA fragment was custom labeled using (³H)TTP (GE Healthcare) and terminal transferase to a specific activity of 420 Ci/mmol (GE Healthcare). We prepared human p53 using recombinant baculovirus (kindly provided by K. Okamoto, Columbia University, New York, NY, USA) by infecting Sf9 insect cells and taking total cell extracts on different days postinfection. We quantitated the total protein in the cell extracts using bicinchoninic acid (Sigma-Aldrich, St. Louis, MO, USA) and the p53 protein specifically using a p53 enzyme-linked immunosorbent assay (ELISA) kit (Oncogene Research Products, Cambridge, MA, USA).

Gel Shift and SPA of p53 DNA Binding

We confirmed DNA binding by the p53 using EMSAs following the method of Okamoto and Beach (18). We then used those conditions to develop a DNA binding SPA. The SPA conditions were generally 0.08 µCi (0.19 pmol) ³H-labeled DNA, 100 ng anti-p53 monoclonal antibody (pAb421; Oncogene Research Products), and 1 µg nonspecific DNA [double-stranded poly(dA-dT)] with 0.5–100 ng p53 (usually between 0.5 and 20 µL) in binding buffer [20 mM HEPES, pH 7.5, 1 mM EDTA, 1 mM dithiothreitol (DTT), 10 mM ammonium sulfate, 30 mM KCl, and 0.2% Tween® 20] in 20 µL. The assay was configured in a standard 96-well white microtiter plate and incubated at room temperature for 5–30 min, followed by the addition of 0.5–2 mg polyvinyl toluene (PVT) protein A SPA beads (GE Healthcare; RPNQ0019) in 50–100 µL binding buffer. Radioactivity bound to the SPA bead was measured using a TopCount Microtiter plate counter (Perkin Elmer, Boston, MA, USA). Specific counts were determined by subtracting a reaction containing water instead of cell extract. We also found no significant difference between the background counts detected when using the extraction buffer. Other monoclonal antibodies against p53 (Oncogene Research Products) were also used at the same concentration as the pAb421 antibody. The poly(dA-dT) nonspecific DNA was replaced in some experiments with poly(dI-dC) or poly-L-lysine at the same concentration. DNA containing a mutant form of the cyclin G promoter with three bases different from the wild-type, known to disrupt EMSA DNA binding (18), was used to test specificity and had the sequence 5′-TGCCAAGGATTTCCCGGTCAGGTCCT/AGGCCAGACCTGACCGGGAAATCCTTGGCA-3′.