to BioTechniques free email alert service to receive content updates.
ΦC31-mediated cassette exchange into a bacterial artificial chromosome
 
Leander Blaas, Monica Musteanu, Rainer Zenz, Robert Eferl, Emilio Casanova
Ludwig Boltzmann Institute for Cancer Research, Vienna, Austria
BioTechniques, Vol. 43, No. 5, November 2007, pp. 659–664
Full Text (PDF)

Introduction

Use of bacterial artificial chromosomes (BACs) for the generation of transgenic mice has gained popularity in recent years. The large cloning capacity of BAC-based vectors, accommodating up to 300 kb, makes them a unique tool to manipulate the mouse genome. In the past, several techniques using homologous recombination in Escherichia coli have been developed allowing the modification of BACs, thus opening the possibility to manipulate BACs in many different ways, such as deletions, insertions, and point mutations (1,2,3). Although induced homologous recombination in E. coli has been shown to be quite reliable during the manipulation of BACs, the modification of BACs with targeting constructs containing repetitive elements, such as expanded trinucleotide repeats or large targeting constructs containing several duplicate elements (e.g., promoters or polyadenylation signals), can be jeopardized by undesirable recombination events, thus significantly increasing the amount of work needed to obtain the final construct. To overcome this problem, we have developed a ΦC31 integrase-mediated cassette exchange into a BAC. The ΦC31 integrase catalyzes recombination between a pair of heterologous sites named attP and attB (4). In contrast with other recombinases, such as Cre and FLP, recombination between the attP and attB sites results in the generation of two new sites named attL and attR. The recombination is not reversible, thus making the ΦC31 integrase a very attractive tool for cassette exchange (5). This work describes the modification of a BAC containing the Rosa 26 locus with a cassette flanked by minimal attP sites as docking site, and later, its ΦC31 integrase-mediated cassette exchange with a complex 16.5-kb incoming sequence containing repeated elements flanked by attB sites.

Materials and Methods

Modification of a BAC Containing the Rosa 26 Locus with an Ampicillin Cassette Flanked by attP Sites

A 200-kb BAC (RP24–85L15) containing the Rosa 26 locus was purchased from Children's Hospital Oakland Research Institute (CHORI; Oakland, CA, USA). A cassette containing an ampicillin resistance gene flanked by two minimal attP sites (4,5) (pattP-ampicillin-attP plasmid; GenBank accession no. EU100102) was recombined into the exon 2 corresponding to the antisense transcript of the Rosa 26 locus (6). Modification of the Rosa 26 BAC was performed as previously described (3,7). Briefly, a construct containing 200-bp upstream homology region to Rosa 26 antisense exon 2 region, an ampicillin gene flanked by two minimal attP sites (in a direct orientation), and a 200-bp downstream homology region to Rosa 26 antisense exon 2 was assembled. The upstream homology region was amplified by PCR from the BAC DNA, using the oligonucleotides 36 5′-TTTTTTGAATTCGTGGAAACACTCTTGTCTTTTCTCC-3′ and 37 5′-TTTTTTCTCGAGGAGATGTTTCTAAAAGGACCAACAGTC-3′. The sequence of the minimal attP site used was 5′-GACCCTACGCCCC CAACTGAGAGAACTCAAAGGTTA CCCCAGTTGGGGCAC-3′ (4,5). The downstream homology region to the Rosa 26 antisense exon 2 was amplified using the oligonucleotides 38 5′-TTTTTTTTAATTAATGTGACACTCAAGAAGCTACCAGAG-3′ and 39 5′-TTTT TTGCTAGCCTGATTCTGCAGGCCGACTTCAG-3′ (bold characters correspond to the annealing region of the oligonucleotides). E. coli DH10B cells harboring the Rosa 26 BAC were transformed with the pSC101-BAD-gbaA, an Ori temperature sensitive plasmid that allows inducible homologous recombination in E. coli (Gene Bridges, Dresden, Germany), and cells were grown at 30°C up to an OD600 of 0.2 and induced with L-arabinose (0.2% final concentration), shifted to 37°C until the OD600 reached 0.5 and electrocompetent cells were made. One microgram of linearized targeting construct (attPampicillin-attP flanked by upstream and downstream homology regions to the exon 2 of the antisense transcript of the Rosa 26 locus) was electroporated, and the bacteria were seeded in agar plates containing 12.5 µg/mg chloramphenicol and 50 µ/mL ampicillin. Homologous recombination of the targeting cassette into the Rosa 26 BAC was confirmed by PCR and Southern blot analysis.

ΦC31 Integrase-Mediated Cassette Exchange

In order to test the feasibility of the technique, an incoming construct containing several repeated elements was assembled by classical cloning technology. The incoming construct harbors three modules. Module 1 (M1) contains a human ubiquitin promoter, a gene of interest (Stat3β), 5×GTX [an artificial internal ribosome binding site (8)], and the enhanced yellow fluorescence protein followed by a simian virus 40 (SV40) polyadenylation signal. Module 2 (M2) contains a second ubiquitin promoter, Stat5α, 5×GTX, and the red fluorescence protein (dsRFP followed by a SV40 polyadenylation signal). Module 3 (M3) is identical to M1 and M2, except for the IKKbeta as a gene of interest, a human truncated form of CD2 and a PGKneo cassette with a bacterial promoter (Tn5) that confers neomycin and kanamycin resistance in eukaryotic and prokaryotic cells, respectively. The construct was assembled in pBluescript flanked by two minimal attB sites (5′-GTGAGG TGGAGTACGCGCCCGGGGAGCCCAAGGGCACGCCCTGGCACCCGCA-3′) in a direct orientation (4,5). The open reading frame of the ΦC31 integrase, containing a c-myc tag at the C terminus, was amplified using the primers 66 5′-TTTTTTCTGCAGCAATTGATGGACACGTACGCGGGTGCTTAC-3′ and 67 5′-TTTTTTTCTAGACAATTGCTAAAGATCTTCTTCAGAAATAAGCTTTTGTTCCGCCGCTACGTCTTCCGTGCCG-3′ and the pBS-phiC31 vector as template (5). Subsequently, it was cloned into the pSC101-BAD-gbaA EcoRI/MunI. The resultant pSC101-BAD-ΦC31-int vector is a tetracycline resistant plasmid with a temperature sensitive origin of replication that allows the expression of ΦC31 integrase in E. coli upon induction with L-arabinose. The pSC101-BAD-ΦC31-int vector was electroporated into E. coli DH10B harboring the Rosa 26 BAC previously modified with an attP-ampicillin-attP cassette (docking BAC). E. coli cells (50 mL) were grown at 30°C in the presence of 50 µg/mL ampicillin and 3 µg/mL tetracycline until the OD600 reached 0.2. At this point, L-arabinose was added with a final concentration of 0.2%, and the culture was shifted to 37°C (to allow the expression of the ΦC31 integrase) and grown until the OD600 reached 0.5. The culture was harvested and electrocompentent cells were made. One hundred nanograms of the incoming construct were linearized with NotI and electroporated to the bacteria, which were further incubated for 1.5 h at 37°C. After electroporation, the bacteria were seeded in agar plates containing 12.5 µg/mL chloramphenicol (BAC selection) and 25 µg/mL kanamycin (incoming construct selection). Kanamycin-cloramphenicol resistant colonies were screened by the loss of ampicillin resistance using replica plates. Cassette exchange in kanamycin resistant, ampicillin sensitive colonies was confirmed by PCR using the oligonucleotides P1 5′-AAGCCGGTCTTGTCGATCAGG and P2 5′CCCCGCAGCCGTTTGTTCAAAGCC-3′. Southern blot analysis was done using an internal probe hybridizing the incoming sequence (probe 71) and an external probe (probe 72) hybridizing both on the parental BAC and the BAC that has undergone cassette exchange. Restriction enzyme digestion analysis (PmeI, SfiI, and SrfI) was used to test the integrity of the incoming construct after cassette exchange in the BAC by comparing the modified BAC with the original construct.

  1    2    3