Francisella tularensis is one of the most deadly bacterial agents, yet most of the genetic determinants of pathogenesis are still unknown. We have developed an efficient targeted mutagenesis strategy in the model organism F. tularensis subsp. novicida by utilizing universal priming of optimized antibiotic resistance cassettes and splicing by overlap extension (SOE). This process enables fast and efficient construction of targeted insertion mutations in F. tularensis subsp. novicida that have characteristics of nonpolar mutations; optimized targeted mutagenesis strategies will promote the study of this mysterious bacterium and facilitate vaccine development against tularemia. Moreover, the general strategy of gene disruption by PCR-based antibiotic resistance cassette insertion is broadly applicable to many bacterial species

Introduction

Francisella tularensis is considered one of the most deadly bacterial agents by the Centers for Disease Control. Yet very little is known about the genetic basis of F. tularensis pathogenesis, primarily because of a historical lack of study of this organism. The development of quick and efficient techniques to genetically manipulate F. tularensis is critical for a deeper understanding of virulence mechanism(s), which in turn is necessary for the development of effective vaccines against tularemia. F. tularensis subsp. novicida exhibits low virulence in humans and high virulence in mice, but its virulence mechanism(s) appear virtually identical to those employed by F. tularensis subsp. tularensis, which is highly virulent to humans. These F. tularensis subspecies are also extremely closely related at the genomic level, and thus F. tularensis subsp. novicida has emerged as a model to study the pathogenesis of the subspecies more virulent to humans. Recent advances in genetic manipulation have facilitated mutant F. tularensis strain construction, including transposon and insertional antibiotic cassette mutagenesis (1,2,3). However, these types of techniques tend to result in disruption of the expression of downstream genes within the same operon (i.e., polarity). Also, due to the random nature of transposition, this technique requires significant screening of numerous mutants to obtain the desired targeted mutation. We have optimized an effective way to make targeted mutations in F. tularensis subsp. novicida that have characteristics of nonpolar mutations.

Materials and Methods

Bacterial Strains

Escherichia coli strain DH5α (4) was used for all cloning experiments, and F. tularensis subsp. novicida strain U112 (5) was used for strain construction. The F. tularensis subsp. novicida ΔiglC::ermC strain has been described previously (3).

Plasmid Construction for Antibiotic Resistance Genes

In order for the antibiotic resistance genes to be efficiently expressed in F. tularensis subsp. novicida, we cloned these genes behind the constitutively expressed F. tularensis subsp. novicida FTN1451 promoter (6). The FTN1451 promoter was PCR-amplified with FpUpBglII and FpDnNdeI primers, digested with BglII and NdeI, and ligated into pET15b (Novagen, Madison, WI, USA) that had been similarly digested to form pKEK886; this construct has the FTN1451 promoter in place of the T7 promoter. Then, the erythromycin, kanamycin, and chloramphenicol resistance genes (7,8,9) were amplified with ErmCFNdeI and ErmCRBamHI, KanFNdeI and KanRBamHI, and CATFNdeI and CATRBamHI, respectively. The three fragments were each cut with BamHI and NdeI and inserted into similarly digested pKEK886, resulting in pKEK887 (FpermC), pKEK898 (FpKan), and pKEK923 (Fpcat), respectively.

Primer Design and PCR Conditions

Universal priming sites were designed from the backbone sequence of pET15b to facilitate amplification of any antibiotic resistance gene inserted between the two priming sites (i.e., in pKEK887, pKEK898, and pKEK923). The universal primers used to PCR-amplify the antibiotic resistance genes are UniUp, 5′-TGCAT TAGGAAGCAGCCCAGTAGT-3′ and UniDn, 5′-TTCCTTTCGG GCTTTGTTAGCAGC-3′. Complementary sequences were incorporated into the primers used to amplify the F. tularensis subsp. novicida flanking DNA regions necessary to construct the gene knockout. As an example, the sequences of the primers used to knock out the iglB gene (FTT1358, FTN1323) are described here. The upstream 904-bp iglB flanking fragment was PCR-amplified with primers IglBUp1, 5′-GAATTCGTCGACGTGTCTTAGCAACTGTACCAGCTAGAGG-3′ (SalI site is in bold) and IglBUp2, 5′-ACTACTGGGCTGCTTCCTAATGCAGCGC CATAAGGTTTCTAGCATTGTAGTC-3′ (note the complementary sequence to UniUp is underlined). The downstream 929-bp iglB flanking fragment was PCR-amplified with primers IglBDn1, 5′-GC TGCTAACAAAGCCCGAAAGGAAA TCGAGGTTGAAACCATACCGGGT-3′ (note the complementary sequence to UniDn is underlined) and IglBDn2, 5′-GAATTCGTCGACGGCAAATAGCTTGCGGTGCTTAAC-3′ (SalI site in bold). Chromosomal DNA from F. tularensis subsp. novicida U112 was utilized as the template in PCRs with IglB primers. PCR conditions were 10 ng DNA, 5 µM each primer, 8 mM dNTPs, 5 µL 10× buffer, 0.5 µL KOD XL DNA polymerase (Novagen) in 50 µL total volume. The PCR program utilized was 94°C 10 min; followed by 30 cycles of 94°C 60 s, 60°C 80 s, and 72°C 110 s; and a final 72°C step for 10 min.