Introduction

In Drosophila, a variety of advanced methods has been developed to manipulate gene expression. They include ectopic gene expression by the Gal4/UAS system (1,2), RNA-mediated interference (RNAi) (3,4), and mosaic analysis of mutant tissue generated by mitotic recombination (5). The common principle of these techniques is their interference with gene expression at the transcriptional or translational level. A major drawback of these methods is that the proteins escape direct experimental manipulation. Thus, in vivo gene analysis is hampered by the lack of techniques that target the actual proteins directly and specifically. Only a few methods are available in Drosophila that can target proteins specifically, such as conditionally splicing inteins (6) or protein photoinactivation by FlAsH-FALI (7).

We developed an in vivo technique for the defined protein cleavage in Drosophila that is based on the sequence-specific cleavage activity of the tobacco etch virus (TEV) protease. The protease recognizes an epitope with a seven-amino-acid consensus E-X-X-Y-X-Q-G/S and cleaves between Q and G/S. Although the protease tolerates different amino acids in the X positions, even conservative substitutions largely reduce enzyme activity. The canonical and most efficient substrate of TEV protease is the amino acid sequence ENLYFQS (8,9,10). This particular TEV protease recognition and cleavage site has been widely used to remove epitope tags during the in vitro purification of recombinant proteins.

Here we show that artificial TEV protease cleavage sites mediate target-specific protein cleavage in Drosophila. Furthermore, we phenocopy a lack-of-function mutation in a tissue-specific manner by controlled TEV protease-mediated cleavage of the corresponding protein after its proper intracellular localization.

Materials and Methods

Fly Strains

The following mutant alleles and fly strains were used: the embryonic lethal recessive null alleles mega¹² and mega⁴⁴(11); btlGal4 drives Gal4 expression ubiquitously in the tracheal system from stage 10 onwards (12); G445Gal4 drives Gal4 expression in ectodermally derived tissues; tubulinGal4, actinGal4, UAS-lacZ, balancers, and marker chromosomes were obtained from the Bloomington Stock Center (Indiana University, Bloomington, IN, USA).

Constructs

The following DNA constructs were cloned by standard molecular methods and through site-directed mutagenesis (QuikChange Site-Directed Mutagenesis kit; Stratagene, La Jolla, CA, USA). UAS-TEV and hs-TEV: the TEV protease coding sequence [sequence for the nuclear inclusion protein A, see National Center for Biotechnology Information (NCBI): M15239 and NP_734212] was cloned from pACYCDuet-1 vector (Novagen, San Diego, CA, USA; gift from A. Herzig Max-Planck-Institut für Biophysikalische Chemie) via KpnI and NcoI restriction sites into pSL1180 (Pharmacia, Pfizer, New York, NY, USA). Subsequently, the TEV coding sequence was cloned into pUAST (1) via EcoRI and KpnI to generate UAS-TEV. For hs-TEV, the TEV coding sequence was cloned from UAS-TEV into pCaSpeR-hs (13) via EcoRI and XbaI restriction sites. UAS-mycTEV: the TEV protease coding sequence was cloned from pUAST-TEV into pCMV-Myc (Clontech, Mountain View, CA, USA) via EcoRI and KpnI restriction sites, and the resulting mycTEV cassette was introduced into pUAST via XbaI. TaoNter-YFP-TEVpcs-TaoCter: tao was cloned via NotI and XbaI into pUAST to generate pUAST-Tao. We amplified the yellow fluorescent protein (YFP) coding sequence from pVENUS-N1 (14) and attached a TEV protease cleavage site (TEVpcs) by PCR at the 3′ end using the primers 5′-AGCATCACCGGTATGGTGAGCA-3′ and 5′-GTTGACCGGTGCCCTGAAAATA-CAGGTTCTCCTTGTACAGCTC-GTCCATGCCGAGAGTGATCCC-3′. The YFP-TEVpcs PCR product was cloned into the TOPO pCR2.1 vector (Invitrogen, Carlsbad, CA, USA). The AgeI restriction fragment was subsequently cloned into the natural AgeI restriction site of the tao coding sequence in pUAST-Tao. mega rescue: 2.4 kb genomic Drosophila DNA encompassing the mega transcribed region, as well as 700 bp upstream and 130 bp downstream sequences, were amplified by PCR using genomic DNA from OreR flies as template with the primers 5′-GAATTCCTCCG-GTTCAGCATGTAC-3′ and 5′-CGG GATCCGATCACATCCGCACCTC ATCAC-3′ and cloned via EcoRI and BamHI into pCaSpeR4 (13). Mega-TEVpcs-YFP rescue: coding sequences for the TEVpcs and YFP were amplified by PCR using pVENUS-N1 (14) as template with the primers 5′-ATAAGAATGCGGCCGCGAGAACCTGTATTTTCAGGGCGGCATGGTGAGCAAGGGCGAGGA-3′ and 5′-ATAAGAAT GCGGCCGCTTACTTGTACAGCTC-GTCCATGCC-3′ digested by NotI and introduced in frame into an artificial NotI restriction site (generated by site-directed mutagenesis) at the 3′ end of the mega coding sequences in the mega rescue construct. Mega-TEVpcs rescue: the coding sequence for TEVpcs and the mega C terminus was amplified by PCR with the primers 5′-GCGGCCG CCGAGAACCTGTATTTTCAGGGC GCCTACGACGCCCGCGGCGAGC AGA-3′ and 5′-CGGGATCCGATCACATCCGCACCTCATCACCAG-3′using mega rescue as template (to create a TEVpcs between amino acids 217 and 218 of Mega). The PCR fragment was digested by NotI and BamHI and cloned via an artificial NotI (generated by site-directed mutagenesis) and a BamHI restriction site into the mega rescue construct. The sequence 5′-GAGAACCTGTATTTTCAGGGC-3′ was used as the TEVpcs coding sequence. The transgene constructs were verified by sequencing and used for P element–mediated germline transformation (15). For further analysis, only homozygous viable P element insertion lines were used. Also, at least two independent P element insertion lines of each transgene construct were examined to exclude phenotypes caused by the P element integration sites.