Introduction

pBINPLUS (1) is a widely used binary plant transformation vector. Improvements introduced into pBINPLUS relative to the pBIN19 vector (2) on which it was based included alteration of the position of the NptII selectable marker relative to the multiple cloning site and introduction of an improved Escherichia coli origin of replication and rare restriction sites flanking the multiple cloning site. A limitation of pBINPLUS in applied research programs is the inclusion of proprietary sequences to direct transcription of the selectable marker (3). The use of nonproprietary sequences to control expression of the selectable marker, such as those from the potato Ubi3 gene (4), would facilitate use of the vector in applied research programs as opposed to protected sequences (5). Also, because of both experimental and intellectual property limitations, a variety of selectable markers have been used in binary vectors (6,7,8). The introduction of separate rare restriction sites bordering the selectable marker coding sequence and the entire marker gene would provide added flexibility by allowing modification of this domain in completed binary constructs. For example, a binary construct containing multiple (stacked) transgenes to confer a complex phenotype could be easily modified for applications requiring alternative selectable markers.

Materials and Methods

Construction of the Unique FseI Site for Selectable Marker Sequences

The pBINPLUS/ARS vector (GenBank accession no. DQ320121) was constructed by modification of pBINPLUS. pBINPLUS contains unique ClaI and NruI restriction enzyme sites flanking the selectable marker gene and the left border sequence (Figure 1). The first step in construction was to generate a PCR product containing the left border flanked by ClaI and NruI restriction sites. This was accomplished by PCR amplification from pBINPLUS using primers that amplify the sequence from the 5′ end of the left border to the NruI site. The primer 5′ to the left border (5′-CCCA TCGATGGCCGGCCCAGTACATT AAAAACGTCCGCAATGTGT-3′) was designed to introduce ClaI and FseI sites upstream of the left border sequence when used with a primer (5′-CATCGGAGCGGGTTTAACCTA-C-3′) flanking the NruI site. The resulting 689-bp PCR product was cloned into pCR2.1 using the TA Cloning kit (Invitrogen, Carlsbad, CA, USA). pBINPLUS was digested with ClaI and NruI and phosphatased, and the 689-bp left border PCR product was cloned into the plasmid. The resulting intermediate vector, pBINPLUS-sel contains a unique FseI site for introduction of selectable marker gene sequences (Figure 1).

Figure 1. Construction of pBINPLUS/ARS from pBINPLUS. (Click to enlarge)

Construction of NptII Under Transcriptional Regulation of the Ubiquitin-3 Control Elements

The desired selectable marker gene for insertion into the FseI site of pBINPLUS-sel contained a Ubi3(promoter)-NptII-Ubi3(terminator) bounded by FseI restriction sites and with PmeI sites adjacent to the NptII gene to permit replacement of the reporter gene without requiring extensive modification of the binary plasmid. The selectable marker gene was constructed in three segments. First, the previously characterized potato Ubi3 promoter and ubiquitin coding region (4) was used as a template for PCR amplification using primers designed to add a 5′ FseI site (5′-GATCGGCCGGCCATACTTATCGATTTAAAT-3′) and a 3′ PmeI site (5′-TCGAGTTTAAACCTTCGCCT GGAGGAGAGAAATC-3′). Second, the NptII gene from pBINPLUS was amplified using primers to introduce PmeI sites at both the 5′ (5′-GAAATT TCATGATTGAACAAGATGGATT GC-3′) and 3′ (5′-GATCGTTTAAAC AGATCCCGTGGGCGAAGAAC-3′) ends. The 5′ primer was designed such that the NptII coding sequence would be introduced in frame with the ubiquitin monomer (Figure 2) (4). The resulting translational fusion is processed such that the NPTII protein has an N-terminal residue (serine) with stabilizing properties similar to the methionine of authentic NPTII (9). The resulting PCR product was cloned into pCR2.1 using the TA Cloning kit. The polyadenylation signal of Ubi3 (4) was amplified in a similar manner using primers (5′-GATCCAAATTTT GATTTTAATGTTTAGCAAATG-3′ and 5′-TCGAGGCCGGCCAATA GTCTCGACAGACACATAGC-3′) to introduce PmeI and FseI sites to the 5′ and 3′ ends, respectively. The resulting PCR products were cloned into pCR2.1.

Figure 2. Nucleotide sequence of the junction of the chimeric Ubi3-ubiquitin-NptII translational fusion construct. (Click to enlarge)

Assembly of pBINPLUS/ARS

To construct pBINPLUS/ARS, pBINPLUS-sel was digested with FseI, phosphatased, and ligated with combined FseI/PmeI fragments from the above Ubi3 promoter and terminator pCR2.1 clones. The resulting intermediate plasmid contained the Ubi3 promoter/terminator sequences flanking a unique PmeI site into which the NptII PCR product described above was cloned. The resulting pBINPLUS/ARS plasmid was verified by sequence analysis of the region containing the selectable marker and left border.

Results and Discussion

To evaluate pBINPLUS/ARS in potato, the vector containing an antisense solanidine glycosyltransferase gene (10) was introduced into potato via Agrobacterium-mediated transformation as described previously (4,11). A transformation using 100 microtuber discs yielded 38 transgenic lines that actively expressed NPTII and the antisense transgene (10), an efficiency similar to that using vectors with other selectable markers (11). The pBINPLUS/ARS has been successfully used to introduce constructs into potato (12,13,14), tobacco (16), and tomato (17,18). It is currently being used for transformation in laboratories around the world in both model systems and additional crop species (Table 1). The pBINPLUS/ARS plasmid is available to all researchers in academic, government, and industrial laboratories.

Table 1. Transgenic Plants Regenerated Using pBINPLUS/ARS (Click to enlarge)