Introduction

MicroRNAs (miRNAs) are small, noncoding sequences of 20–23 nucleotides that regulate cell processes by binding to the 3′ untranslated region (UTR) of mRNAs resulting in its translation repression; it is predicted that they regulate thousands of human genes (1,2,3). miRNAs are transcribed as long primary precursor molecules (pri-miRNA) that are subsequently processed by the nuclear enzyme Drosha to the precursor miRNA (pre-miRNA). The pre-miRNA, in turn, is processed by Dicer to generate the mature miRNA (4). miRNA expression is critical in oncogenesis (2,5,6,7). Increased miRNA expression in cancers is associated with the down-regulation of tumor suppressors while miRNAs that are reduced in cancer may normally suppress oncogenes (2,5,6,7).

miRNA expression analyses have used real-time RT-PCR (8,9,10), Northern blot analysis (1,4), or microarrays (2) that can detect either the precursor (8,9,10) or, more commonly, the mature form of the molecule (10). Relatively few studies on miRNA expression have used in situ-based techniques (5,11,12,13,14). Thus, there is evidence lacking to show that, in cancers, only the malignant cells—and not the adjacent normal tissue—are expressing the miRNA of interest. RT in situ PCR can be used to detect the miRNA precursors: since it is very sensitive, a negative result would effectively rule out the production of miRNA precursors (5,14,15). The in situ detection of miRNAs has been assisted by the use of locked nucleic acid (LNA)–modified nucleotides (13,16). The LNA nucleotides are much more rigid in three-dimensional space, which results in a substantial increase in the T_m of the small LNA-modified oligonucleotide probe hybridized to its target miRNA (17). It has been demonstrated by some that the LNA-modified probe can detect either the miRNA precursors or mature miRNA depending on which specific sequence in the pre-miRNA is targeted (18,19).

We have developed a novel method for the in situ detection of the mature miRNA based on the extension of the molecule after its hybridization to an ultramer template. This method, like RNA-primed, array-based, Klenow enzyme (RAKE) analysis, is based on the RNA molecule acting as a primer to initiate the reaction (12). However, unlike RAKE, which is only effective in solution phase reactions, our system allows for the in situ analysis of the mature miRNA. This novel method—along with the two established in situ methods of RT in situ PCR and in situ hybridization with LNA probes—were used to study the spatial patterns of different microRNAs in a variety of malignant cell lines, as well as in normal and cancerous tissues.

Materials and methods

Solution phase extension of miR-376a

Mature miR-376a oligoribonucleotide was synthesized by IDT (Coralville, IA, USA) and gel-purified. miR-376a oligomer (1 µg) was end-labeled with γ-P³² ATP and T4 kinase. The labeled miR-376a oligomer was used to prime a miR-376a ultramer, and the oligos were extended using a variety of enzymes including rTth reverse transcriptase (Applied Biosystems, Foster City, CA, USA), Taq DNA polymerase (Promega, Madison, WI, USA), MMLV reverse transcriptase (Invitrogen, Carlsbad, CA, USA), MultiScribe reverse transcriptase (Applied Biosystems), and T7 RNA polymerase (Epicentre, Madison, WI, USA), according to each company's protocol. The extension products were verified on a 12% polyacrylamide, 6 M urea denaturing gel.

Cell lines and tissue samples

Tissue samples (from the files of G.J.N.) and cell preparations (HL-60 and Jurkat cell lines, provided by colleagues at Ohio State University Medical Center) were immediately fixed in 10% buffered formalin for 4–12 h at room temperature; buffered formalin is the optimal fixative for RNA in situ hybridization (15). All tissues were obtained via an approved protocol from the Ohio State University Medical Center Internal Review Board. We focused on cardiac and central nervous system (CNS) tissues, as these have been well associated with particular miRNAs [miR-1 (20), and miR-128a (21) (S. Lawler, unpublished data)], respectively. Furthermore, since mature miR-128a is decreased in the malignant counterpart (glioblastoma multiforme) (S. Lawler, unpublished data), this allowed us to study the in situ correlates of mature miRNA down-regulation in these cancerous tissues.

Ultramer extension method

General principle

The ultramer is at least 100 nucleotides in size. At its 5′ end, it consists of a series of four 20-nucleotide repeats (GACCCCTTAATGCGTCTAAA), ending at the 3′ end with the complementary sequence of the miRNA of interest. A DNA or RNA polymerase will extend the miRNA using the ultramer as the template (see Figure 1, panel A with miR-1 as the example). As the miRNA is being extended, the newly synthesized DNA incorporates the reporter nucleotide digoxigenin (Figure 1A). The repetitive sequence allows the use of a complementary oligonucleotide (TTTAGACGCATTAAGGGGTC) that can be added at the onset of the reaction that will inhibit the extension of the miRNA. This serves as an additional negative control to document the specificity of the reaction.