Full Text (PDF)
Detection and quantitation of nucleic acids within biological samples are routinely performed by monitoring absorbances of solutions at 260 nm. Absorbance spectrophotometry is also a valuable tool for analysis of alterations in the secondary structure of DNA, RNA, and related molecules such as poly(ADP-ribose) (1,2). This latter assessment takes advantage of the well-known hyperchromicity of DNA and RNA, resulting from intrinsic differences in absorbance among nucleotides and single-stranded and double-stranded species. In addition, absorbance measurements at 220 nm and 280 nm are frequently employed to detect and quantitate proteins, while other wavelengths within this range are used to analyze structural changes induced within DNA and RNA upon binding of biomolecules or exogenous chemicals (1)(3,4,5).
Plastic containers used for the storage and manipulation of biological samples are constructed of complex polymer materials containing multiple chemical additives. These additives include supplements such as chemical antioxidants, mold release agents, biocides, and UV-light stabilizers (6,7). Plastic materials may also contain other low–molecular weight chemicals such as residual unreacted monomers and polymer degradation products. Several past studies have demonstrated that additives and other chemicals can leach from plastics into the environment (8,9,10,11,12,13). A diffusable monomer component within polycarbonate, bisphenol A (BPA), has received much attention in recent years because of its widespread distribution and its ability to act as an endocrine disruptor in animals (8,9). Concern has also been raised about release of formaldehyde, antimony, phthalates and various polymer breakdown products from drinking bottles and other plastic containers (10,11,12,13).
Biochemistry researchers use small,1.5-mL polypropylene microcentrifuge tubes (microtubes) during purification, handling, and storage of nucleic acids, proteins, and other biological samples. Specialty tubes, such as the thin-walled 0.2-mL polypropylene microtubes used for PCR experiments, are also frequently employed. Polypropylene, like other commercial plastics, contains multiple additives that protect and preserve the integrity of the polymer material (7,12). Tubes molded from this plastic have proven invaluable for biological research because of their useful mechanical properties, resistance to extreme temperatures, and low chemical reactivity.
Materials and methods UV light absorbance spectroscopyUV absorbance measurements utilized a SmartSpec 3000 spectrophotometer (Bio-Rad, Hercules, CA, USA) with the scan smoothing function activated. Leachate absorbance experiments described in Figures 1–2 were performed using VWR polypropylene microtubes (Cat. no. 20170–038; Schertz, TX, USA) unless specified otherwise. DNA oligonucleotide Pvu4a (AAATGAGTCACCCAGATCTAAATAA) was obtained from BioServe Biotechnologies (Laurel, MD, USA) and analyzed using 77 µg/mL solutions. DNA concentration calculations were performed using the relationship that an A260 of 1.0 corresponds to a concentration of 33 µg/mL for single-stranded DNA oligonucleotides (1). Chloroform, DMSO, and methanol were obtained from Sigma-Aldrich (St. Louis, MO, USA). PCR was simulated using a 2720 Thermal Cycler from Applied Biosystems (Foster City, CA, USA). Sonication was performed using a Vibracell VC130 sonicator (Sonics & Materials, Inc., Newtown, CT, USA) set at an amplitude of 30. Standard micro-centrifuge tubes tested in these studies included the following brands and catalog numbers: VWR (Cat. no. 20170–038), Ambion/Applied Biosystems (Cat. nos.12400 and 12300), Sarstedt (Fisher, Cat. no. 50809206; Newton, NC, USA), Axygen MCT-175-A (VWR Cat. no. 10011–718), Intermountain Scientific Corporation (Cat. no. C-3261–3; Kaysville, UT, USA), Vangard (Cat. no. CN065S-GT; Vangard International, Inc., Neptune, NJ, USA), and Fisherbrand (Fisher, Cat. no. 02–681–376). Two tubes recently advertised to contain fewer mold release agents (Axygen MCT-150-C; VWR 10011–700) or plasticizers, slip agents, and biocides (Cat. no. 022364111; Eppendorf, Hauppauge, NY, USA) were also tested. PCR tubes (0.2-mL, thin-walled) tested included the following brands: Labcon (VWR, Cat. no. 21070–012), Ambion/Applied Biosystems (Cat. no. AM12225), Nalgene (Genunc, Cat. no. #250865; Lima, OH, USA), ISC BioExpress (GeneMate, Cat. no. C-3257–1), and VWR brand tubes (Cat. no. 20170–010).