Figure 1. Construction of plasmid Pmyo-3:RFP-IRES-GFP:let858.3′. (Click to enlarge)

Worm culture, transformation, and microscopy

Wild-type (wt) C. elegans strain N2 was maintained at 22°C on nematode growth medium (NGM) according to standard methods (11). Five to six worms were moved to a new plate before microinjection. The worms were injected with the Pmyo-3::RFP-IRES-GFP::let858.3′ PCR product with mixtures of pRF4 (carrying a dominant rol-6 allele) at a ratio of 1:4. Control plasmid 1 [Pmyo-3::RFP-24ES(285 bp)-GFP::let858.3′] and control plasmid 2 (GFP-IRES-GFP::let858.3′) were each injected as mixtures with pRF4 at the same concentration. Roller phenotype transgenic worms, whether exhibiting both RFP and GFP fluorescence or not, were selected using an Olympus IX71 microscope coupled with a Digital Processing Center (DPC) controller (Olympus, Tokyo, Japan).

Single Worm PCR

A single roller phenotype transgenic worm was picked into 10 µl worm lysis buffer and frozen in liquid nitrogen. The lysed worm was incubated at 65°C for 1 h and at 95°C for 10 min. PCR reactions were performed using RFP gene-specific primers RFP-F:ATGGCCTCCTCCG AGA ACGTCATCA and RFP-R: CTACAGGAACAGGTGGTGGCGGCCC and GFP gene-specific primers GFP-F: ATGAGTAAAGGAGAAGAACTTTTCA and GFP-R: TTACTTGTATGGCCGGCTAGCGAAT to identify the specific genes in the worm.

Western blot analysis

One hundred roller phenotype worms were lysed in 1 × SDS-PAGE buffer. The worm lysate proteins and Easysee Exposure Marker (Transgen) were separated by SDS-PAGE on 12% gels and transferred to nitrocellulose membranes using a Mini Trans-Blot Electrophoretic Transfer Cell (Bio-Rad, Hercules, CA, USA). After blocking with 5% (w/v) milk, membranes were incubated with a rabbit anti-GFP antibody (1:1000; Proteintech Group, Chicago, IL, USA) for 1 h at 37°C, After washing three times with PBS-Tween (PBS-T), membranes were incubated for 30 min with an anti-rabbit horseradish peroxidase-conjugated secondary antibody (1:2000; MACGENE International, Beijing, China). After washing three times with PBS-T, membranes were incubated with ECL reagent (PerkinElmer, Waltham, MA, USA) for 1 min. Membranes were then exposed to X-ray film to develop the image. RFP was also detected using goat anti-RFP antibody (1:200; Santa Cruz Biotechnology, Santa Cruz, CA, USA) and anti-goat antibody (1:2000; MACGENE International).

Results and discussion

In order to test if the predicted IRES sequence identified in the Hsp-3 gene was functional, we constructed a bicistronic vector with an expression cassette consisting of the myo-3 promoter, RFP gene, the putative IRES, GFP gene, and the let-858 3′ sequence. In transgenic worms carrying this Pmyo-3:RFP-IRES-GFP:let858.3′ construct, RFP and GFP fluorescence was observed in muscle tissue (Figure 2 and Supplementary Movie S1, S2) in two independent transgenic lines. To verify the fluorescence seen in the transgenic worms was due to fluorescent protein (FP) expression and not autofluorescence, Western blot analysis was carried out and confirmed RFP and GFP expression in Pmyo-3:RFP-IRES-GFP:let858.3′ transgenic worms, while no expression was evident in wt worms (Figure 3).

Figure 2. Transgenic worm expressing RFP and GFP from the Pmyo-3:RFP-IRES-GFP:let858.3′ bicistronic vector. (Click to enlarge)

Figure 3. Western blot analysis of GFP and RFP expressed in transgenic worms from the Pmyo-3:RFP-IRES-GFP:let858.3′ bicistronic vector. (Click to enlarge)

To confirm the IRES sequence is necessary for expression of the downstream GFP gene, we examined transgenic worms containing the control construct Pmyo-3:RFP-24ES(285bp)-GFP:let858.3′, in which the IRES was replaced with the Hemonchus contortus 24ES sequence. In transgenic roller worms, RFP, but not GFP, fluorescence was observed (Figure 4A). Single worm PCR verified that both FP sequences were integrated in the Pmyo-3:RFP-24ES(285bp)-GFP:let858.3′ transgenic worms (data not shown). To confirm that the IRES sequence does not act as a cryptic promoter for the downstream GFP gene, we also injected the control construct RFP-IRES-GFP:let858.3′, which lacks the myo-3 promoter and failed to detect expression of either FP in the transgenic worms by fluorescence microscopy (Figure 4B) or Western blot analysis (data not shown). PCR verified that both FP sequences were integrated into the roller transgenic worms (data not shown). Two independent transgenic lines were analyzed for each of the two control constructs.