Full Text (PDF)
pIX5.0-HaLys encoding the H-chain of anti-lysozyme Fab without signal peptide sequence was constructed similar to pIX5.0- Mel-HaLys, except that the melittin sequence described above was replaced by 5'-GAGCCCATGG and NcoI was used for cloning instead of BspHI.
Mel-VLCL-SII encoding anti-CD4 (13B.8) Fab L-chain with a C-terminal Strep-tag and Mel-VHCH1 (H-chain) were produced as linear templates by Expression-PCR using the EasyXpress Linear Template Kit Plus (Qiagen, Hilden, Germany). The gene specific primers for H-chain 5′-GTATACATTTCTTACATCTATGCGGACCAGGTTCAGCTGAAACAGTC-3′ (forward), 5′-CTTG GTTAGTTAGTTATTAGCAAGATTTGGGCTCAACTT-3′ (reverse) and L-chain 5′-GTATACATTTCTTACATCTATGCGGACGATATCCAGATGA CCCAGTC-3′ (forward), 5′-GGATGA GACCAGGCAGAACACTCTCCGCGGTTGAAG-3′ (reverse) and a StarGate vector containing the anti-CD4 (13B.8) sequence (IBA, Göttingen, Germany) as the template were used for the first PCR step according to the manufacturer's protocol. For construction of pIX5.0-Mel- Epo-N52+110Q encoding human erythropoietin (Epo) amino acid codons for asparagine 52 and 110 of pIX4.0-Epo (27) were changed to glutamine codons by site directed mutagenesis in order to inactivate two of the three N-glycosylation sites of the protein. Using PCR, the sequence encoding the native signal peptide of Epo was replaced by a sequence for honey bee melittin signal peptide and restriction sites for XbaI and BglII were introduced using the forward primer 5'-GATAAATCATGAAATTCTTAGTCAACGTTGC
CCTTGTTTTTATGGTCGTATACATTTCTTACATCTATGCGGACCC
ACCACGCCTCATCTGTG-3' and reverse primer 5'-TTA TTTAGATCTTTATCTGTCCCCTGTCCTG-3'. The PCR product was subcloned into pIX5.0 using restriction enzymes NcoI and XhoI for the vector and BspHI and XhoI for the gene.
Cell lysate of Spodoptera frugiperda was prepared as described (15), except that the elution buffer for chromatography of the supernatant of centrifugation did not contain the reducing agent DTT (dithiothreitol). The lysate was incubated with a final concentration of 6.9 U/mL S7 micrococcal nuclease and 1 mM CaCl2 (all from Roche, Mannheim, Germany) for 20 min at 20°C. Incubation was stopped by supplementation with 5 mM EGTA (Sigma-Aldrich, Taufkirchen, Germany) and cooling on ice. Coupled transcription/translation reactions consisted of 35% (v/v) nuclease treated cell lysate and 30 mM HEPES-KOH (pH 7.6), 2.9 mM Mg(OAc)2, 75 mM KOAc (all from Sigma-Aldrich), 0.25 mM spermidine (Serva, Heidelberg, Germany), 20 mM creatine phosphate, 1.75 mM ATP, 0.3 mM each of CTP, GTP and UTP (all from Roche), 0.33 mM p1-(guanosyl)p3-[5′ (guanosyl)] triphosphate (Sigma-Aldrich), 2.5 mM oxidized glutathione, 0.5 mM reduced glutathione (Roche), 100 U/mL RNase inhibitor RNasin (Promega, Mannheim, Germany), 50 U/mL T7 RNA polymerase, 17.5 µg/mL baker's yeast tRNA (all from Roche), 0.1 mM each of the 19 naturally occurring amino acids (Merck, Darmstadt, Germany) except leucine and 0.1 µg/mL creatine kinase (Roche). For single expression 15 µg/mL plasmid DNA and for coexpression of light and heavy chains from different templates 7.5 µg/mL of each plasmid was used. The reactions were supplemented with 0.1 mM L-[U-14C]leucine (PerkinElmer, Rodgau, Germany) with a molar activity of 0.667 Bq/pmol. Reactions were incubated 4 h at 25°C.
Quantification of the synthesized protein and gel electrophoresisProtein quantification was done by trichloro acetic acid precipitation of radioactively labeled protein followed by scintillation counting as described (18). Autoradiography of SDS gels was performed as described (18) using a Typhoon imager (Amersham Pharmacia, Freiburg, Germany). A sample buffer without reducing agent was used for non-reducing electrophoresis and the samples were incubated 30 min at 37°C instead of boiling.
Activity assayFor calculation of the activity of anti-lysozyme Fab, 20 ng hen egg-white lysozyme (Sigma-Aldrich) with a specific activity of 56,400 U/mL was incubated with different volumes of reaction samples after lysis of microsomes using detergent as described in Results and discussion. Specific inhibition of lysozyme dependent lysis of Micrococcus lysodeicticus cells (Sigma-Aldrich) was measured as described previously (18).
Proteinase K protection assayAfter transcription/translation, six microliter reaction samples were incubated 10 min at 25°C with strong shaking in the absence or presence of 0.05% Bri35 (Thermo Scientific, Rockford, IL, USA) that is needed for lysis of microsomal vesicles. The samples were further incubated for 20 min at 25°C in the absence or presence of 0.1 or 0.5 mg/mL proteinase K (Roche) followed by addition of 5% trichloro acetic acid, incubation for 10 min at 56°C and 30 min precipitation on ice. After centrifugation at 16.000× g for 30 min, pellets were washed with ice-cold acetone, dried, and dissolved in sample buffer for SDS-PAGE. Analysis was done by SDS-PAGE and autoradiography of the radioactively labeled proteins.