to BioTechniques free email alert service to receive content updates.
Simultaneous digital quantification and fluorescence-based size characterization of massively parallel sequencing libraries
 
Matthew T. Laurie1, Jessica A. Bertout1, Sean D. Taylor1, Joshua N. Burton2, Jay A. Shendure2, and Jason H. Bielas1,3, 4
Full Text (PDF)

Ligation of DNA size standards to adapter sequences

The DNA fragments were ligated to the following sequences containing the Nextera version 1 adapters (Epicenter Biotechnologies, Madison, WI):

Adapter 1:

5′-CAAGCAGAAGACGGCATACGAGAT

TCGCCTTACGGTCTGCCTTGCCAGCCCGCTCAGAG

ATGTGTATAAGAGACAG[index 1]CCC-3′

Adapter 2:

5′-GGG[index 2]CTGTCTCTTATACACATCTCTGAT

GGCGCGAGGGAGGCGCGATCTAG

TGTAGATCTCGGTGGTCGCCGTATCATT-3′

All size standard fragments were ligated to adapters with the following 7 bp indices:

Index 1: 5′- TACCTCT-3′

Index 2: 5′- ACACATT-3′

Ligations were carried out in 20 µL reactions containing 1 µL T4 DNA Ligase and 2 µL 10× T4 DNA Ligase Buffer (New England BioLabs, Ipswich, MA). The ligation reactions were incubated at room temperature for 2 h. The ligated DNA was purified with a phenol/chloroform/isoamyl alcohol extraction. All samples were sent to the Fred Hutchinson Cancer Research Center ABI capillary sequencing facility to verify that the correct insert had been ligated to the adapters in each sample.

Library preparation for Illumina MiSeq

Samples of the plasmid pET-23a were sheared to an average size of 150 bp using the Covaris S220 Ultrasonicator (Covaris, Woburn, MA). The sheared DNA was run on a 1.0% UltraPure Low-Melting Point Agarose gel and a gel slice corresponding to ∼100–200 bp was manually excised and purified using the QIAcube gel extraction protocol. The sheared DNA was blunted and phosphorylated using the Quick Blunting Kit (New England BioLabs) and purified with a phenol/chloroform/isoamyl alcohol extraction.

Eight samples of sheared DNA were ligated to adapter sequences with unique 7 bp indices in separate 20 µL reactions containing 1 µL T4 DNA Ligase and 2 µL 10× T4 DNA Ligase Buffer. The ligation reactions were incubated at room temperature for 2 h. All ligations were purified with a phenol/chloroform/isoamyl alcohol extraction.

All ligated libraries were amplified with 20 cycles of standard PCR using the following primer sequences:

Primer 1:

5′-AATGATACGGCGACCACCGA-3′

Primer 2:

5′-CAAGCAGAAGACGGCATACGA-3′

The amplified libraries were quantified using the ddPCR system (Bio-Rad, Hercules, CA) and the Quant-iT PicoGreen assay (Invitrogen). In the ddPCR experiment, the libraries were run in parallel with adapter-ligated size standards to allow for the estimation of library size distribution. The measured concentrations of the 8 differently indexed libraries were used to dilute and combine the libraries in a molar ratio of 100:50:10:1 with 2 libraries at each concentration. The combination of libraries was denatured and diluted in preparation for loading onto the MiSeq flow cell (Illumina, San Diego, CA) as per the Illumina protocol.

Genomic DNA was purified from the human colon cancer cell line HCT 116 using the QIAcube automated purification protocol with the DNeasy Kit (QIAGEN). The Nextera XT DNA Sample Preparation Kit (Illumina) was used to generate a MiSeq compatible library from the HCT 116 DNA. The optional bead-based normalization step in the Nextera XT protocol was omitted and the library was instead normalized by quantification with ddPCR and the volume was adjusted to 2 nM as required by the MiSeq loading protocol. The 2 nM library was denatured and further diluted as per the manufacturer's guidelines. The standard phi X control library (Illumina) was spiked into the denatured HCT 116 library at 5% by volume. The library and phi X mixture were then loaded into a MiSeq 300-Cycle v2 Reagent Kit (Illumina).

TaqMan probe and primer design

The following primers (Invitrogen) and TaqMan probe (Applied Biosystems, Foster City, CA) were designed to hybridize to the Nextera adapter sequences:

Primer 1:

5′-GCGACCACCGAGATCTACAC-3′

Primer 2:

5′-AGCAGAAGACGGCATACGAG-3′

  1    2    3    4    5