to BioTechniques free email alert service to receive content updates.
Decomposition of waste DNA with extended autoclaving under unsaturated steam
 
Tetsushi Suyama and Mamoru Kawaharasaki
National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Ibaraki, Japan
BioTechniques, Vol. 55, No. 6, December 2013, pp. 296–299
Full Text (PDF)
Abstract

Carryover and false-positive amplification of undesired DNA sequences are serious problems in research and diagnostic testing using PCR. One possible source of DNA cross-contamination can be the autoclave if DNA contained in waste is not effectively decomposed and contaminates the autoclave. To assess this possibility, we used a 2682 bp PCR product as a model waste DNA and quantified the amplifiability of an 84 bp short fragment derived from the model waste DNA in the steam and the residual bottom water after autoclaving. Autoclaving under the standard conditions of 121°C for 20 min did not sufficiently remove amplifiability from the model DNA and was found to be a possible source of laboratory contamination. However, the amplifiable template was removed after autoclaving at 121°C for 80 min. Fragmentation and hydrolysis may occur during autoclaving, and the presence of atmospheric oxygen facilitated the decomposition. These findings will help researchers develop better strategies for disposing of DNA waste.

For thermo-tolerant microorganisms, autoclaving with saturated steam (100% steam containing no air) at 121°C for 15–20 min has been considered sufficient for sterilizing samples, reagents, growth media, plastic, and glass (1, 2). However, many reports indicate that the 121°C for 15–20 min method is not suitable for inactivating PCR-amplifiable DNA in samples, reagents, plastic and glass (3-8). It has also been suggested that the aerosol derived from inactivated Staphylococcus cells can cause cross-contamination in the autoclave chamber (9). But there remain situations in which one cannot avoid autoclaving waste that contains genomic DNA, plasmids, PCR products, etc.

Here, we assess the possibility of DNA cross-contamination and leakage during autoclaving. A PCR product (2682 bp, GC content = 50.6%, amplified from a linearized pUC19 plasmid) was used as model waste DNA. A short, high-GC content fragment (84 bp, GC content = 61.9%) from that PCR product was quantified. Such fragments are known to be particularly difficult to remove (3, 4, 7, 10, 11). It has been reported that uncapped processing with saturated steam at 121°C for 120–180 min prevents PCR amplification of DNA markers in dried saliva stains using forensic human genotyping kits (7). The fact that 120–180 min autoclaving effectively removes the template activity of DNA means it is possible to operate an autoclave chamber for disposal of DNA waste, but leakage of contaminants must still be carefully avoided. Our study was designed to ascertain the effect of extended autoclaving on amplifiable template removal in laboratory waste, with a focus on preventing DNA contamination from the autoclave.

Method Summary

Here we assess the possibility of DNA cross-contamination and leakage during autoclaving. A PCR product (2682 bp, GC content = 50.6%, amplified from a linearized pUC19 plasmid) was used as model waste DNA. A short, high-GC content fragment (84 bp, GC content = 61.9%) from that PCR product was quantified in the steam and residual bottom water after autoclaving by using microfluidic digital PCR and real-time PCR.

Materials and methods

A PCR product (2682 bp, GC content = 50.6%) was amplified from a HindIII digest of pUC19 plasmid, using ExTaq polymerase (Takara, Shiga, Japan) with forward (5′-TGGCGTAATCATGGTCATAGCTG) and reverse (5′-TGCATGCCTGCAGGTCGACTC) primers. The crude product was used in the following experiments.

The autoclave (Model KS-243; Tomy Seiko Co., Ltd. Tokyo, Japan) used in this study had the following features: 22 L in effective internal chamber volume, automatic displacement of chamber air by saturated steam before achieving 121°C, and automatic control of chamber temperature and pressure by exhausting steam during heating and sterilization. The chamber was washed with a large volume of water before the experiment. Cleanliness was assessed by a blank test without loading DNA samples at the beginning and at the time of every other leak-test with loading of model waste DNA described below, as well as at the end of the series of experiments. Two liters of fresh water (deionized water, 15 MΩcm,free of template DNA) were placed in the autoclave chamber, and the samples were placed at the center of the stainless steel basket. Autoclaving started at room temperature. All samples were collected from the chamber after cooling to 35°C. The water at the bottom of the chamber (bottom water) was also collected through the drain after cooling down to 35°C. For steam collection, the exhaust was collected from the exhaust hose in a 20 L heat-resistant plastic bag, chilled with crushed ice, during the steps of heating, sterilizing at 121°C, and cooling to 100°C.

The bottom water (~1.9 L) and the water derived from steam (~100 mL) were condensed and buf fer-exchanged with TE (final volume 100 µL) using Vivaspin 15R (VS15RH02) and Vivacon 500 (VN01H02) concentrators (Hydrosart 10,000 MWCO; Sartorius Stedim Biotech GmbH, Göttingen, Germany), which are capable of collecting DNA molecules larger than 30 bp at an efficiency of 94% (www.sartorius.com). Samples for prolonged autoclaving (PCR product in TE buffer and water) were also prepared using the Vivacon 500 concentrator.

The template copy number in the standard samples was counted by digital- PCR assay with three separate panels of a 12.765 Digital Array (Fluidigm, South San Francisco, CA) for each sample. Sample copy number was determined before and after processing by duplicate real-time PCR assays in reference to standard samples using a 7900HT Sequence Detection system (Applied Biosystems, Foster City, CA). A pair of primers (5′- CTGTCGTGCCAGCTGCATTA and 5′- GAGCGAGGAAGCGGAAGAG) and a TaqMan probe (5′FAM- ATCGGCCAACGCGCGGG-3′ TAMRA; Applied Biosystems) were designed for detecting a short region (84 bp, GC content = 61.9%) in the 2682 bp PCR product and were utilized for digital-PCR and real-time PCR assays. Data represent mean ± SD of duplicate real-time PCR assays unless otherwise specified.

  1    2    3