to BioTechniques free email alert service to receive content updates.
Production of single-stranded DNAs by self-cleavage of rolling-circle amplification products
 
Hongzhou Gu1,2 and Ronald R. Breaker1,2, 3
1Department of Molecular, Cellular and Developmental Biology, Yale University, New Haven, Connecticut, United States
2Howard Hughes Medical Institute, New Haven, Connecticut, United States
3Department of Molecular Biophysics and Biochemistry, Yale University, New Haven, Connecticut, USA
BioTechniques, Vol. 54, No. 6, June 2013, pp. 337–343
Full Text (PDF)
Abstract

DNA molecules that encode a small, high-speed self-hydrolyzing deoxyribozyme are used as templates for rolling circle amplification (RCA) to produce single-stranded DNAs (ssDNAs) of single- and multiple-unit lengths. Including self-cleaving deoxyribozymes in RCA products can generate large amounts of ssDNAs with defined sequence and length as well as precise termini. We also demonstrate the use of this method to efficiently generate ssDNA size markers by using deoxyribozyme reaction conditions that permit partial processing.

Deoxyribozymes are DNA molecules that form structures capable of catalyzing chemical reactions (1-3). Given the central role of DNA in genetic information storage and its importance in biotechnology, deoxyribozymes might find utility in engineered organisms or as reagents for various molecular applications (4-6). Of particular interest to us are DNAs that catalyze self-processing reactions (7-10). Such deoxyribozymes could be harnessed to create DNA constructs that become modified based on their inherent catalytic activities when exposed to specific reaction conditions. For example, engineered self-cleaving deoxyribozymes that employ oxidation (7), depurination (8), or hydrolysis (9-12) mechanisms have been created by using various directed evolution strategies. Self-cleaving deoxyribozymes that operate with appropriate reaction rates and chemical characteristics might find broad utility for various applications involving DNA cleavage.

Recently, we identified two classes of engineered self-cleaving deoxyribozymes that hydrolyze DNA with high speed and sequence specificity (13). One such deoxyribozyme, named I-R3 (Figure 1a), carries a small catalytic core composed of 17 nucleotides flanked by either 1 or 2 base-paired substructures. Representatives of this deoxyribozyme class exhibit an observed rate constant (kobs) for DNA hydrolysis of ~1 min−1 (half-life of ~40 s) when incubated at near neutral pH and in the presence of millimolar concentrations of Zn2+. This deoxyribozyme cleaves the phosphoester bond between the 3′ oxygen and the phosphorus center of an ApA linkage to yield a 3′ cleavage fragment with a 5′ phosphate group (Figure 1b).




Figure 1.  Schematic representation of a class I self-hydrolyzing deoxyribozyme and its chemical reaction. (Click to enlarge)


We speculated that an efficient self-cleaving deoxyribozyme would be useful for cleaving multimeric ssDNA products that are generated by RCA. RCA generates concatemer DNA products since DNA polymerase is using a circular DNA template (14, 15). Whereas most applications involving RCA exploit its ability to amplify weak biochemical signals in various diagnostic systems (16, 17), a self-cleaving deoxyribozyme would permit the concatemers to be resolved into unit-length DNA products.

Materials and methods

Rolling circle amplification (RCA)

A 10 µL or 2 µL aliquot of 1 µM circular DNA template prepared by CircLigase (Epicenter Biotechnologies, Madison, WI, USA) according to the manufacturer's directions was combined with an equivalent molar amount of primer in a total of 50 µL containing 40 mM Tris-HCl (pH 7.5 at 23°C), 50 mM KCl, 10 mM MgCl2, 5 mM (NH4)2SO4, and 4 mM DTT. To ensure binding of the primer to the template, an annealing procedure was performed by stepwise 2-min incubations at 80°C, 60°C, 45°C, and 23°C. After annealing, 1 µL of 10 mM dNTPs, 1 µL of 10 mg/mL BSA, and 2 µL of 10 unit/µL Phi 29 DNA polymerase (New England BioLabs, Ipswich, MA, USA) were added to initiate DNA synthesis. The reaction was incubated at 30°C for 4 h and stopped by inactivating the enzyme at 65°C for 10 min. The products were precipitated with 2.5 volumes of 100% ethanol, centrifuged to recover the DNA pellet, and resuspended in a 50 µL solution containing 50 mM HEPES (pH 7.0 at 23°C) and 100 mM NaCl.

Method summary

Here we report a novel method to generate large amounts of single-stranded DNA of defined length and sequence using self-hydrolyzing deoxyribozymes. Self-hydrolyzing deoxyribozyme reactions

The ssDNA concatemers from RCA were allowed to fold by 2-min stepwise incubations at 80°C, 60°C, 45°C, and 37°C. At 37°C, the self-cleavage reaction was initiated by mixing the above 50 µL solution with an additional 50 µL containing 50 mM HEPES (pH 7.0 at 23°C), 100 mM NaCl, and 4 mM ZnCl2. At different time points (2 min, 5 min, 15 min, 30 min, 1h, and 2h), a 10 µL aliquot was removed and mixed with 10 µL stop buffer containing 95% formamide and 20 mM EDTA. Products were separated by 8%PAGE or 1.5% agarose electrophoresis under denaturing or non-denaturing conditions as indicated for each experiment. Bands were visualized with SYBR Gold nucleic acid gel stain (Invitrogen, Grand Island, NY, USA) and imaged by UV transillumination. Purification of ss100 DNA ladder products

The ten shortest ss100 DNA ladder products (ranging from 100 to 1000 nucleotides) were separated by denaturing (8 M urea) 8% PAGE. The bands were visualized by UV shadowing, individually excised from the gel, and combined in one tube prior to elution by crush-soaking overnight in 10 mM Tris-HCl (pH 7.5 at 23°C), 200 mM NaCl, and 1 mM EDTA. DNA was recovered from solution by the addition of 2.5 volumes 100% ethanol followed by centrifugation. The resulting DNA pellet was resuspended in deionized H2O and samples were used for electrophoresis mobility assays using agarose gel. Oligonucleotides

A list of oligonucleotides used in this study is provided below. Underlined sequences in the template strands encode the I-R3 deoxyribozyme. ss50, ss100, and ss200 refer to the template DNAs used to generate ssDNA ladders of the increment lengths indicated.

ss50 DNA Template
5′-pTAGGTAACGCTTCAACGTCACATTCTG
TGACAGCTCAACTACGTTAC
TTG

ss50 DNA Primer
5′-GTTACCTACAAGTAACGTA

ss100 DNA Template
5′-pCTTGACTGCTTATGAGCATGGTGTATATGTGCCGAATTAG
GTAACGCTTCAACGTCACATTCTGTGACAGCTCAACTACGTTAC
TTGGTCTGCAATGATA

ss100 DNA Primer
5′-AGCGTTACCTAATTCG

ss200 DNA Template
5′-pCTTGACTGCTTATGAGCATGGTGTATATGTGCCGAATTAG
GTAACGCTTCAACGTCACATTCTGTGACAGCTCAACTACGTTAC
TTGGTCTGCAATGATAGAATGTGGTATTCCTAAATCTAACTGATGAATCTTTCTACCTGT
AATAATGTTGTTCCGTTAGTTCGTATGATTAACGTAGATATCTCTCCTCAGCATA
ss200 DNA Primer

5′-AGCGTTACCTAATTCG Results and discussion

To demonstrate the activity of a self-cleaving deoxyribozyme, we sought to prepare a collection of ssDNAs of defined sequence and length, wherein RCA amplification products ranged from a single-unit DNA (100 nucleotides) to greater than 10 unit DNA repeats in the concatemeric sequence (Figure 2). We reasoned that such a range of DNA products might be useful as ssDNA size markers (DNA ladders) for gel electrophoresis applications. Our studies were initiated by preparing a 100-nucleotide circular DNA template for RCA. This was generated from a synthetic DNA template prepared by solid-phase chemical synthesis. The synthetic DNA template includes a 44-nucleotide sequence complementary to deoxyribozyme I-R3 along with 56 randomly-chosen nucleotides. The synthetic DNA was ligated to form a ssDNA circle by using CircLigase, a protein enzyme that efficiently couples a linear DNA carrying both 5′ phosphate and 3′ hydroxyl termini (Figure 2, i) (18).



  1    2